bio/db/soft.rb - Interface for SOFT formatted files
Author |
Trevor Wennblom <trevor@corevx.com> |
Copyright |
Copyright © 2007 Midwinter Laboratories, LLC (midwinterlabs.com) |
License |
The Ruby License |
“SOFT (Simple Omnibus in Text Format) is a compact, simple, line-based, ASCII text format that incorporates experimental data and metadata.” – GEO, National Center for Biotechnology Information
The Bio::SOFT module reads SOFT Series or Platform formatted files that contain information describing one database, one series, one platform, and many samples (GEO accessions). The data from the file can then be viewed with Ruby methods.
Bio::SOFT also supports the reading of SOFT DataSet files which contain one database, one dataset, and many subsets.
Format specification is located here:
SOFT data files may be directly downloaded here:
NCBI’s Gene Expression Omnibus (GEO) is here:
If an attribute has more than one value then the values are stored in an Array of String objects. Otherwise the attribute is stored as a String.
The platform and each sample may contain a table of data. A dataset from a DataSet file may also contain a table.
Attributes are dynamically created based on the data in the file. Predefined keys have not been created in advance due to the variability of SOFT files in-the-wild.
Keys are generally stored as Symbols. In the case of keys for samples and table headings may alternatively be accessed with Strings. The names of samples (geo accessions) are case sensitive. Table headers are case insensitive.
require 'bio' lines = IO.readlines('GSE3457_family.soft') soft = Bio::SOFT.new(lines) soft.platform[:geo_accession] # => "GPL2092" soft.platform[:organism] # => "Populus" soft.platform[:contributor] # => ["Jingyi,,Li", "Olga,,Shevchenko", "Steve,H,Strauss", "Amy,M,Brunner"] soft.platform[:data_row_count] # => "240" soft.platform.keys.sort {|a,b| a.to_s <=> b.to_s}[0..2] # => [:contact_address, :contact_city, :contact_country] soft.platform[:"contact_zip/postal_code"] # => "97331" soft.platform[:table].header # => ["ID", "GB_ACC", "SPOT_ID", "Function/Family", "ORGANISM", "SEQUENCE"] soft.platform[:table].header_description # => {"ORGANISM"=>"sequence sources", "SEQUENCE"=>"oligo sequence used", "Function/Family"=>"gene functions and family", "ID"=>"", "SPOT_ID"=>"", "GB_ACC"=>"Gene bank accession number"} soft.platform[:table].rows.size # => 240 soft.platform[:table].rows[5] # => ["A039P68U", "AI163321", "", "TF, flowering protein CONSTANS", "P. tremula x P. tremuloides", "AGAAAATTCGATATACTGTCCGTAAAGAGGTAGCACTTAGAATGCAACGGAATAAAGGGCAGTTCACCTC"] soft.platform[:table].rows[5][4] # => "P. tremula x P. tremuloides" soft.platform[:table].rows[5][:organism] # => "P. tremula x P. tremuloides" soft.platform[:table].rows[5]['ORGANISM'] # => "P. tremula x P. tremuloides" soft.series[:geo_accession] # => "GSE3457" soft.series[:contributor] # => ["Jingyi,,Li", "Olga,,Shevchenko", "Ove,,Nilsson", "Steve,H,Strauss", "Amy,M,Brunner"] soft.series[:platform_id] # => "GPL2092" soft.series[:sample_id].size # => 74 soft.series[:sample_id][0..4] # => ["GSM77557", "GSM77558", "GSM77559", "GSM77560", "GSM77561"] soft.database[:name] # => "Gene Expression Omnibus (GEO)" soft.database[:ref] # => "Nucleic Acids Res. 2005 Jan 1;33 Database Issue:D562-6" soft.database[:institute] # => "NCBI NLM NIH" soft.samples.size # => 74 soft.samples[:GSM77600][:series_id] # => "GSE3457" soft.samples['GSM77600'][:series_id] # => "GSE3457" soft.samples[:GSM77600][:platform_id] # => "GPL2092" soft.samples[:GSM77600][:type] # => "RNA" soft.samples[:GSM77600][:title] # => "jst2b2" soft.samples[:GSM77600][:table].header # => ["ID_REF", "VALUE"] soft.samples[:GSM77600][:table].header_description # => {"ID_REF"=>"", "VALUE"=>"normalized signal intensities"} soft.samples[:GSM77600][:table].rows.size # => 217 soft.samples[:GSM77600][:table].rows[5] # => ["A039P68U", "8.19"] soft.samples[:GSM77600][:table].rows[5][0] # => "A039P68U" soft.samples[:GSM77600][:table].rows[5][:id_ref] # => "A039P68U" soft.samples[:GSM77600][:table].rows[5]['ID_REF'] # => "A039P68U" lines = IO.readlines('GDS100.soft') soft = Bio::SOFT.new(lines) soft.database[:name] # => "Gene Expression Omnibus (GEO)" soft.database[:ref] # => "Nucleic Acids Res. 2005 Jan 1;33 Database Issue:D562-6" soft.database[:institute] # => "NCBI NLM NIH" soft.subsets.size # => 8 soft.subsets.keys # => ["GDS100_1", "GDS100_2", "GDS100_3", "GDS100_4", "GDS100_5", "GDS100_6", "GDS100_7", "GDS100_8"] soft.subsets[:GDS100_7] # => {:dataset_id=>"GDS100", :type=>"time", :sample_id=>"GSM548,GSM543", :description=>"60 minute"} soft.subsets['GDS100_7'][:sample_id] # => "GSM548,GSM543" soft.subsets[:GDS100_7][:sample_id] # => "GSM548,GSM543" soft.subsets[:GDS100_7][:dataset_id] # => "GDS100" soft.dataset[:order] # => "none" soft.dataset[:sample_organism] # => "Escherichia coli" soft.dataset[:table].header # => ["ID_REF", "IDENTIFIER", "GSM549", "GSM542", "GSM543", "GSM547", "GSM544", "GSM545", "GSM546", "GSM548"] soft.dataset[:table].rows.size # => 5764 soft.dataset[:table].rows[5] # => ["6", "EMPTY", "0.097", "0.217", "0.242", "0.067", "0.104", "0.162", "0.104", "0.154"] soft.dataset[:table].rows[5][4] # => "0.242" soft.dataset[:table].rows[5][:gsm549] # => "0.097" soft.dataset[:table].rows[5][:GSM549] # => "0.097" soft.dataset[:table].rows[5]['GSM549'] # => "0.097"
data table row defined by absence of line type character
Constructor
Arguments
lines: (required) contents of SOFT formatted file
Returns |
# File lib/bio/db/soft.rb, line 147 def initialize(lines=nil) @database = Database.new @series = Series.new @platform = Platform.new @samples = Samples.new @dataset = Dataset.new @subsets = Subsets.new process(lines) end
# File lib/bio/db/soft.rb, line 381 def custom_raise( line_number_with_0_based_indexing, msg ) raise ["Error processing input line: #{line_number_with_0_based_indexing+1}", msg].join("\t") end
# File lib/bio/db/soft.rb, line 354 def error_msg( i, extra_info=nil ) case i when 10 x = ["Lines without line-type characters are rows in a table, but", "a line containing an entity indicator such as", "\"#{LINE_TYPE_ENTITY_INDICATOR}SAMPLE\",", "\"#{LINE_TYPE_ENTITY_INDICATOR}PLATFORM\",", "or \"#{LINE_TYPE_ENTITY_INDICATOR}DATASET\" has not been", "previously encountered or it does not appear that this line is", "in a table."] when 20 # tables are allowed inside samples and platforms x = ["Tables are only allowed inside SAMPLE and PLATFORM.", "Current table information found inside #{extra_info}."] when 30 x = ["Entity attribute line (\"#{LINE_TYPE_ENTITY_ATTRIBUTE}\")", "found before entity indicator line (\"#{LINE_TYPE_ENTITY_INDICATOR}\")"] when 40 x = ["Unkown entity indicator. Must be DATABASE, SAMPLE, PLATFORM,", "SERIES, DATASET, or SUBSET."] else raise IndexError, "Unknown error message requested." end x.join(" ") end
# File lib/bio/db/soft.rb, line 272 def process(lines) current_indicator = nil current_class_accessor = nil in_table = false lines.each_with_index do |line, line_number| line.strip! next if line.nil? or line.empty? case line[0].chr when LINE_TYPE_ENTITY_INDICATOR current_indicator, value = split_label_value_in( line[1..-1] ) case current_indicator when 'DATABASE' current_class_accessor = @database when 'DATASET' current_class_accessor = @dataset when 'PLATFORM' current_class_accessor = @platform when 'SERIES' current_class_accessor = @series when 'SAMPLE' @samples[value] = Sample.new current_class_accessor = @samples[value] when 'SUBSET' @subsets[value] = Subset.new current_class_accessor = @subsets[value] else custom_raise( line_number, error_msg(40, line) ) end when LINE_TYPE_ENTITY_ATTRIBUTE if( current_indicator == nil ) custom_raise( line_number, error_msg(30) ) end # Handle lines such as '!platform_table_begin' and '!platform_table_end' if in_table if line =~ %{table_begin} next elsif line =~ %{table_end} in_table = false next end end key, value = split_label_value_in( line, true ) key_s = key.to_sym if current_class_accessor.include?( key_s ) if current_class_accessor[ key_s ].class != Array current_class_accessor[ key_s ] = [ current_class_accessor[ key_s ] ] end current_class_accessor[key.to_sym] << value else current_class_accessor[key.to_sym] = value end when LINE_TYPE_TABLE_HEADER if( (current_indicator != 'SAMPLE') and (current_indicator != 'PLATFORM') and (current_indicator != 'DATASET') ) custom_raise( line_number, error_msg(20, current_indicator.inspect) ) end in_table = true # may be redundant, computationally not worth checking # We only expect one table per platform or sample current_class_accessor[:table] ||= Table.new key, value = split_label_value_in( line ) # key[1..-1] -- Remove first character which is the LINE_TYPE_TABLE_HEADER current_class_accessor[:table].header_description[ key[1..-1] ] = value else # Type: No line type - should be a row in a table. if( (current_indicator == nil) or (in_table == false) ) custom_raise( line_number, error_msg(10) ) end current_class_accessor[:table].add_header_or_row( line ) end end end
# File lib/bio/db/soft.rb, line 386 def split_label_value_in( line, shift_key=false ) line =~ %{\s*=\s*} key, value = $`, $' if shift_key key =~ %{_} key = $' end if( (key == nil) or (value == nil) ) puts line.inspect raise end [key, value] end
Generated with the Darkfish Rdoc Generator 2.